R two days. Glucose uptake of PNStreated C2C12 cells was assessed working with the Screen QuestTM Fluorimetric Glucose Uptake Assay Kit (AAT Bioquest, CA, USA) following the manufacturer’s guidelines. About 50 lL in the 2deoxyglucose (2DG) uptake assay mixture was detected making use of a FLUOstar Omega microplate reader (BMG LABTECH, Offenburg, Germany) at ExEm = 544590 nm.Homeostasis model assessment of insulin resistanceFasting serum insulin (Fins) was analyzed making use of the Mouse Ultrasensitive Insulin ELISA kit (ALPCO, Salem, NH, USA). Briefly, the samples in a 96well plate were incubated with 10 lL of insulin Chemical Inhibitors Related Products antibody and 50 lL of streptavidin orseradish peroxidase (in the kit) at 37 for 60 min. The coloring reagent was added for the samples inside the dark for ten min at 37 . Finally, the quit reagent was added and also the absorbance at 450 nm was detected. The insulin resistance index was calculated as: Homeostasis Model Assessment of Insulin Resistance (HOMAIR) = FBG (mmol ) 9 Fins (mIU) L22.five.AnimalsSevenweekold KKAy and C57BL6J mice (Institute of Healthcare Laboratory Animals, Chinese Academy of Healthcare Sciences, Beijing) have been singly housed within the Beijing Experimental Animal Analysis Center as outlined by a protocol approved by the Beijing University of Chinese Medicine Animal Care Committee. C57BL6J mice had been fed a standard chow diet program (HFK Bioscience Co., Beijing, China) under 55 ten humidity and 12 h12 h lightdarkness with totally free access to drinking water at 23 2 . KKAy mice have been fed a high fat diet regime (78.8 basal diet program, 10 egg yolk powder, ten lard, 1.0 cholesterol, 0.two bile salt; Chinese Academy of Healthcare Sciences Laboratory Animal Investigation Institute). Just after 2 weeks of adaptive feeding, 16 KKAy mice with random blood glucose (RBG) 13.9 mmol more than aBlood lipid assaySerum levels of high density lipoprotein (HDL) cholesterol (C), low density lipoprotein (LDL)C, total cholesterol (TC), and triglycerides (TG) were measured using HDLC,FEBS Open Bio 9 (2019) 1008019 2019 The Authors. Published by FEBS Press and John Wiley Sons Ltd.X. Guo et al.PNS enhance skeletal muscle insulin resistanceLDLC, TC, and TG Kits (Zhong Sheng Bei Kong, Beijing, China) following the manufacturer’s directions.Histology analysisSkeletal muscle was isolated from mice just after they were sacrificed. Muscles were quickly fixed in four paraformaldehyde for 24 h, embedded in paraffin, and then sliced into 5 lmthick sections for hematoxylin and eosin (HE) staining.IRS1 forward primer: 50 AATAGCCGTGGTGATTA CAT30 , reverse primer: 50 CAGAAGCAGAAGCAGAGG30 ; bactin forward primer: 50 TGTTGTCCCTGTATGC CTCT30 , reverse primer: 50 TAATGTCACGCACGATTTCC30 .Western blot analysisProtein concentrations of cells and tissue have been measured with the Protein Quantitative Kit (Applygen Technologies Inc.). Protein samples were separated by 10 SDSPAGE gel and transferred onto a poly(vinylidene difluoride) membrane (Merck Millipore, Bedford, MA, USA) by a semidry transfer (BioRad, Hercules, CA, USA). Following blocking with five milk, the membrane was incubated with primary antibodies overnight at 4 . The key antibodies included: antiphospho (p)PI3Kp85 (1 : 2000, ab182651; Abcam, Cambridge, UK), antipTyr612IRS1 (1 : 2000; Thermo Fisher Scientific), antipAKT (Ser473) (1 : 2000; CST, 4060 Cell Signaling Technologies, Danvers, MA, USA), antiAKT (1 : 1000; CST, 4691 Cell Signaling Technologies), and Bromfenac sodium antiGLUT4 (1 : 1000; ab654 Abcam). Immediately after washing, the membrane was incubated using the corresponding peroxidaselabeled.
